Alignment Window Calculate Menu

• Sort
  • By ID
    This will sort the sequences according to sequence name. If the sort is repeated, the order of the sorted sequences will be inverted.
  • By Length
    This will sort the sequences according to their length (excluding gap characters). If the sort is repeated, the order of the sorted sequences will be inverted.
  • By Group
    This will sort the sequences according to sequence name. If the sort is repeated, the order of the sorted sequences will be inverted.
  • By Pairwise Identity
    This will sort the selected sequences by their percentage identity to the consensus sequence. The most similar sequence is put at the top.
  • The Sort menu will have some additional options if the alignment has any associated score annotation, or you have just done a multiple alignment calculation or opened a tree viewer window.
    
• Calculate Tree or PCA ...
  Opens the calculations dialog for for calculating trees or principal component analysis plots on the alignment or the currently selected region.
  
• Pairwise Alignments
  Applies Smith and Waterman algorithm to selected sequences. See pairwise alignments.
  
• Extract Scores ... (optional)
  This option is only visible if Jalview detects one or more white-space separated values in the description line of the alignment sequences.
  When selected, these numbers are parsed into sequence associated annotation which can then be used to sort the alignment via the Sort by→Score menu.
  
• Translate as cDNA
  This option is visible for nucleotide alignments. Selecting this option shows the DNA's calculated protein product in a new split frame window. Note that the translation is not frame- or intron-aware; it simply translates all codons in each sequence. You can use the standard genetic code, or choose an alternative code table (any incomplete final codon is discarded). You can perform this action on the whole alignment, or selected rows, columns, or regions. Alternative code tables were added in Jalview 2.11.
  
• Reverse, Reverse Complement (not applet)
  These options are visible for nucleotide alignments. Selecting them adds the reverse (or reverse complement) of the sequences (or selected region) as new sequences in the alignment. To try this out, add this sequence and perform 'Reverse Complement' followed by 'Translate as cDNA':
  Seq GTCATTTGCGCGTGTTGATTATTCGGACCGCTCCACTTCCCTTTACTCGTGCGTTCAATTGATTTAATCCTC TGGGGGGGCTCTGGTTTACATAGCTTAAATCTATTCCATTCAAGGAAGCTCATG
  
• Get Cross-References (not applet)
  This option is visible where sequences have cross-references to other standard databases; for example, an EMBL entry may have cross-references to one or more UNIPROT entries. Select the database to view all cross-referenced sequences in a new split frame window.
  
• Autocalculate Consensus
  For large alignments it can be useful to deselect "Autocalculate Consensus" when editing. This prevents the sometimes lengthy calculations performed after each sequence edit.
  
• Sort Alignment With New Tree
  If this option is selected, the alignment will be automatically sorted whenever a new tree is calculated or loaded.
  
• Show Flanking Regions
  Opens a new alignment window showing any additional sequence data either side of the current alignment. Useful in conjunction with 'Fetch Database References' when the 'Trim Retrieved Sequences' option is disabled to retrieve full length sequences for a set of aligned peptides.